View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_93 (Length: 250)
Name: NF9879_low_93
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 881397 - 881165
Alignment:
| Q |
1 |
aggtgaaatggcaggagtgtgcctgaatcatatatctcgagagtccaacgacataaaccgccttgccaaattctatcaagaggtaaccactcatcacata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
881397 |
aggtgaaatggcaggagtgtgcctgaatcatatatctcgagagtccaacgacataaaccgccttgccaaattctatcaagaggtaaccactgatcacata |
881298 |
T |
 |
| Q |
101 |
acaacttatttgtctcaattaaaattcacatgtttggaat-ttttattgtatgattttcagatatttggatttgaagaagtagaaagccccaagttcgga |
199 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
881297 |
acaacttgtttgtctcaatcaaaattcacatatttggaattttttattgtatgattttcagatatttggatttgaagaagtagaaagccccaagttcgga |
881198 |
T |
 |
| Q |
200 |
gagtttaaggttgtatggctacgtgttccatct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
881197 |
gagtttaaggttgtatggctacgtgttccatct |
881165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University