View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_97 (Length: 249)
Name: NF9879_low_97
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 77 - 241
Target Start/End: Complemental strand, 37446602 - 37446438
Alignment:
| Q |
77 |
cattggtttcactagtcccttctcttcaaaagnnnnnnnnnnaatttgtctcaacaatcttcttcattcttgacataaatttctgtctatagaatttgtt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37446602 |
cattggtttcactagtcccttctcttcaaaagttttttttttaatttgtctcaacaatcttcttcattcttgacataaatttctgtctatagaatttgtt |
37446503 |
T |
 |
| Q |
177 |
ttgttgaggtcaaattcttttagtacatagttttgggtcacaattgttatttctttttatctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37446502 |
ttgttgaggtcaaattcttttagtacatagttttgggtcacaattgttatttctttttatctctg |
37446438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University