View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9880_high_13 (Length: 223)
Name: NF9880_high_13
Description: NF9880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9880_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 37489601 - 37489799
Alignment:
| Q |
9 |
aaaaattacatgtactagtatgctttgtatgatatgaatttgaattaccgtgggataaggccacctatagtggacgttccaccaatccatcaatgctttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489601 |
aaaaattacatgtactagtatgctttgtatgatatgaatttgaattaccgtgggataaggccacctatagtggacgttccaccaatccatcaatgctttt |
37489700 |
T |
|
| Q |
109 |
cttgcatcctttggtagtttgccctttttccttttcttgagaaattcctgtcttaagttgctaaggtaacccccatacttacgaagaagcatttcttta |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489701 |
cttgcatcctttggtagtttaccctttttccttttcttgagaaattcctgtcttaagttgctaaggtaacccccatacttacgaagaagcatttcttta |
37489799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University