View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9880_high_5 (Length: 374)
Name: NF9880_high_5
Description: NF9880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9880_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 14 - 374
Target Start/End: Complemental strand, 40661656 - 40661295
Alignment:
| Q |
14 |
caaagatatattctgtgattgttatgcaaaaatatgaatgaatttggttcaaccagacttgcagattctgcacaaaacagactggcttatgctttcagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40661656 |
caaagatatattctgtgattgttatgcaaaaatatgaatgaatttggttcaaccagacttgcagattctgcacaaaacagactggcttatgctttcagct |
40661557 |
T |
 |
| Q |
114 |
tgtacaacacccttccaggacccactcctccagtgcacataatctgccatactaatgaactcacacaaattttcaccatcatcaacacacaccccaaaa- |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
40661556 |
tgtacaacacccttccaggacccactcctccagtgcacataatctgccatactaatgaactcacacaaattgtaaccatcatcaacacacaccccaaaat |
40661457 |
T |
 |
| Q |
213 |
tttatacttaggcaaaccattctgcagcattcatcagcaaatattgtgatccaaaaccaacccttacaccaaactactcttataatcaaatgaagatatt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40661456 |
tttatacttaggcaaaccattctgcagcattcatcagcaaatattgtgatccaaaatcaacccttacaccaaactactcttataatcaaatgaagatatt |
40661357 |
T |
 |
| Q |
313 |
atgttcatagcagatccatatactactagtactttttgttttgaatgacaccctatgctact |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
40661356 |
atgttcatagcagatccatatactactagtactttttgttttgaatgccaccatatgctact |
40661295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University