View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9880_low_12 (Length: 243)
Name: NF9880_low_12
Description: NF9880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9880_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 35173700 - 35173911
Alignment:
| Q |
18 |
ggttgaaatgttaccacaagatcttgctttcacagtttttgttccttctgaagaagcttttaaacgtgatctacgtttgagtgtgaatgatagtttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35173700 |
ggttgaaatgttaccacaagatcttgctttcacagtttttgttccttctgaagaagcttttaaacgtgatctacgtttgagtgtgaatgatagtttgaaa |
35173799 |
T |
 |
| Q |
118 |
caagacaagtttaatgatacatatgcaattgtgagtcgtgtgttgggtttttctgttgtacctcgtacactatgttctgttgatttaaggtttggtgagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35173800 |
caagacaagtttaatgatacatatgcaattgtgagtcgtgtgttgggtttttctgttgtacctcgtacactatgttctgttgatttaaggtttggtgagg |
35173899 |
T |
 |
| Q |
218 |
ttgtgtcctatg |
229 |
Q |
| |
|
||||||| |||| |
|
|
| T |
35173900 |
ttgtgtcttatg |
35173911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University