View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9880_low_18 (Length: 215)
Name: NF9880_low_18
Description: NF9880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9880_low_18 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 123681 - 123498
Alignment:
| Q |
17 |
gcaaagggtgataccttaccgctattctgttctgaaaaccatgagaccaatgctatcaatctctggtacatatctcagaactatacggttaaatgctatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
123681 |
gcaaagggtgataccttaccgctattctgttctgaaaaccatgagaccaatgctatcaatctccggtacatatctcagaactatacggttaaatgctctt |
123582 |
T |
 |
| Q |
117 |
tctgtttattaataagaagtttttcatgatttagttttaagttggagctggaagtggaatataatggatttgcaactaagtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123581 |
tctgtttattaataagaagtttttcatgatgtagttttaagttggagctggaagtggaatataatggatttgcaactaagtttt |
123498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University