View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9882_15 (Length: 306)
Name: NF9882_15
Description: NF9882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9882_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 306
Target Start/End: Complemental strand, 43091841 - 43091547
Alignment:
| Q |
12 |
agcagagagtaaagccaagaagaagaaggcggcgccggcggcggatgaggatgcagactcaccggcagatggaccagatgcagatgcagattctgatgat |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091841 |
agcaaagagtaaagccaagaagaagaaggcggcgccggcggcggatgaggatgcagactcaccggcagatggaccagatgcagatgcagattctgatgat |
43091742 |
T |
 |
| Q |
112 |
cagaaagctgctgatgatgaaaatggagttaatggattaaatcgagggttgagattcattatggtatttttcagtttgtttattggtgctttggttctat |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091741 |
cagaaagctgctgataatgaaaatggagttaatggattaaatcaagggttgagattcattatggtatttttcagtttgtttattggtgctttggttctat |
43091642 |
T |
 |
| Q |
212 |
aattgtgtcggtgtagataaaaactattctacacatgcatgacagctatggtcaaattgtgatagatattcttttcttcatttctttgattttgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091641 |
aattgtgtcggtgtagataaaaactattctacacatgcatgacagctatggtcaaattgtgatagatattcttttcttcatttctttgattttgt |
43091547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University