View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9882_low_6 (Length: 252)
Name: NF9882_low_6
Description: NF9882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9882_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 245
Target Start/End: Original strand, 39947417 - 39947566
Alignment:
| Q |
96 |
gctaattaatggaagttctaaatcttttgaatcagacaagggaaaaacttggattcaagctatgcacagcttatttatcagtgacatactttgatcagtt |
195 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947417 |
gctaattaatgaaagtttataatcttttgaatcagacaagggaaaaacttggattcaagctatgcacagcttatttatcagtgacatactttgatcagtt |
39947516 |
T |
|
| Q |
196 |
tcttttgaagcaacacatacacatccatgtaactatgtcccttcatctca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39947517 |
tcttttgaagcaacacatacacatccatgtaactatgtcccttcaactca |
39947566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 39947319 - 39947362
Alignment:
| Q |
1 |
gccttgtccatttcaacaacatacgtgttaatgccattgaccac |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947319 |
gccttgtccatttcaacaacatacgtgttaatgccattgaccac |
39947362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University