View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9883_low_17 (Length: 244)
Name: NF9883_low_17
Description: NF9883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9883_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 25789670 - 25789495
Alignment:
| Q |
19 |
ggattctgtttcaatcgctttctaagcatacatatcatacgtgtggtgtgagtgcaaactcaaatacacggatgaaaccataacgatgaagatgtaaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
25789670 |
ggattctgtttcaatcgctttctaagcatacatatcatacgtgtggtgtgagtgcaaactcaaatacacgggttaaaccataacgatgaagatgtaaact |
25789571 |
T |
|
| Q |
119 |
actttgatatacataaaagaaattaaagaatatgcattgtcggtctaaaacaactttacattaacatccaatgata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
25789570 |
actttgatatacataaaagaaattaaaggttatgtcttgtcgatctaaaacaactttacactaacatccaatgata |
25789495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University