View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_10 (Length: 402)
Name: NF9884_high_10
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 24 - 395
Target Start/End: Original strand, 24164946 - 24165317
Alignment:
| Q |
24 |
aacaccaccttgtcttaccgcactaagtgcttgcttgaattgttcctcttcatattttactggctcaggtgaattcaaatgcaatcttgcattattttca |
123 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24164946 |
aacaccgccttgtcttaccgcactaagtgcttgcttgaattgttcctcttcatattttactggctcaggtgaattcaaatgcaatcttgcattattttca |
24165045 |
T |
 |
| Q |
124 |
agggctgcagccattggcattgtgccaagaaatttgttaacaggcactctagctggaaatggatgctttaatactggttggttgtctattgtgtcgcttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24165046 |
agggctgcagccattggcattgtgccaagaaatttgttaacaggcactctagctggaaatggatgctttaatactggttggttgtctgttgtgtcgcttt |
24165145 |
T |
 |
| Q |
224 |
tgaccttgttttttatgactgaccctctatcagtagatgttgatcttctaactggaggcgacggtgatcttccttttcctgagcccgctaacttttcttc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165146 |
tgaccttgttttttatgactgaccctctatcggtagatgttgatcttctaactggaggcgacggtgatcttccttttcctgagcccgctaacttttcttc |
24165245 |
T |
 |
| Q |
324 |
ggtgagaagggacatttttggcatggactccttgtccataaatgccgagggaaaccttgacctcctttgctt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24165246 |
ggtgagaagggacatttttggcatggactccttgtccataaatgccgagggaaaccttgacctcctttgctt |
24165317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 171 - 392
Target Start/End: Original strand, 42232814 - 42233035
Alignment:
| Q |
171 |
tctagctggaaatggatgctttaatactggttggttgtctattgtgtcgcttttgaccttgttttttatgactgaccctctatcagtagatgttgatctt |
270 |
Q |
| |
|
|||||||| |||||||| ||| | | ||||||||| |||| ||||| ||||| |||| |||| ||||| || ||||||||||||||| ||||||| |
|
|
| T |
42232814 |
tctagctgtaaatggattcttcgaaattggttggttttctagattgtcgattttggtcttgcttttaatgacagaacctctatcagtagatattgatctc |
42232913 |
T |
 |
| Q |
271 |
ctaactggaggcgacggtgatcttccttttcctgagcccgctaacttttcttcggtgagaagggacatttttggcatggactccttgtccataaatgccg |
370 |
Q |
| |
|
|||| |||||| || ||||| || || | |||| || | || |||||||||| | ||||| ||||||||||| ||||| |||||||||||||||| | |
|
|
| T |
42232914 |
ctaattggaggtgatggtgacctgcccctccctgtgctcactgacttttcttcagacagaagagacatttttggtatggagtccttgtccataaatgttg |
42233013 |
T |
 |
| Q |
371 |
agggaaaccttgacctcctttg |
392 |
Q |
| |
|
||||||| |||| ||| ||||| |
|
|
| T |
42233014 |
agggaaatcttggccttctttg |
42233035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University