View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_12 (Length: 381)
Name: NF9884_high_12
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 9e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 49659966 - 49659863
Alignment:
| Q |
19 |
atgttgacacagattctccacttgttggttcacataacgcgaccaaaacatttttcctctatgcacctttgtgatttgccaagtcacactcccactcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49659966 |
atgttgacacagattctccacttgttggttcacataacgcgaccaaaacatttttcctctatgcacctttgtgatttgccaagtcacactcccactcttc |
49659867 |
T |
|
| Q |
119 |
ctgt |
122 |
Q |
| |
|
|||| |
|
|
| T |
49659866 |
ctgt |
49659863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 185 - 266
Target Start/End: Complemental strand, 49659800 - 49659719
Alignment:
| Q |
185 |
ccacattctgaattctgcaattcttttccctttcttggccttcacttcttcatcatcacatctatttggtaagtgtttactc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49659800 |
ccacattctgaattctgcaattcttttccctttcttggccttcactttttcatcatcacatctatttggtaagtgtttactc |
49659719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 371
Target Start/End: Complemental strand, 49659667 - 49659629
Alignment:
| Q |
333 |
tatttctggaaacttatgtttaatttgtgatatcctatg |
371 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49659667 |
tatttttggaaacttatgtttaatttgtgatatcctatg |
49659629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University