View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_21 (Length: 319)
Name: NF9884_high_21
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 3584274 - 3584576
Alignment:
| Q |
1 |
atacttttagaattaatcagttttatttgatgtactagtagttaccatgcgatccatcaatgtatcactcaaatcagcacctaaaagatgttgcgcnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584274 |
atacttttagaattaatcagttttatttgatgtactagtagttaccatgcgatccatcaatgtatcactcaaatcagcacctaaaagatgttgcgcaaaa |
3584373 |
T |
 |
| Q |
101 |
nnnntcaatgaaattataatacattgtaaaggcgttagatactttttagaaatagaaacccactattaacttatacctgtaaaatttgctttgaatgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584374 |
aaaatcaatgaaattataatacattgtaaaggcgtcagatactttttagaaatagaaacccactattaacttatacctgtaaaatttgctttgaatgcaa |
3584473 |
T |
 |
| Q |
201 |
cagctttctccatgtatgcaccattgaaagtagaaccgctaaaatctgattctctcatatcagcagatgtgaaattggctcttctgtataagtaatttag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584474 |
cagctttctccatgtatgcaccattgaaagtagaaccgctaaaatctgattctctcatatcagcagatgtgaaattggctcttctgtataagtaatttag |
3584573 |
T |
 |
| Q |
301 |
att |
303 |
Q |
| |
|
||| |
|
|
| T |
3584574 |
att |
3584576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University