View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_32 (Length: 254)
Name: NF9884_high_32
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 53597934 - 53598170
Alignment:
| Q |
12 |
agcataggaggagcaagtgggatttcatgatttctagtgcttgtgtgtatagaacactgaattttaatatatgaatttggttggaacctgattatgtgtt |
111 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53597934 |
agcagaggaggagcaaatgggatttcatgatttctagtgcttgtgtgtatagaacactgaattttaatatatgaatttggttggaacctgattatgtgtt |
53598033 |
T |
 |
| Q |
112 |
gtaaaatgttgaatcacatgctttagtagttgtgaggaacaatcccccgtgaatgttatttatttattttgatcaagtactttagtggctacactaacac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53598034 |
gtaaaatgttgaatcacatgctttagtagttgtgaggaacaatcccccgtgaatgttaattatttattttgatcaagtactttagtggctacactaacac |
53598133 |
T |
 |
| Q |
212 |
attataccaatgtcgataaatagtaaattcaaggttcgaac |
252 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
53598134 |
attata--aatg--gataaatagtaaatttaaggttcgaac |
53598170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University