View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_43 (Length: 240)
Name: NF9884_high_43
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3413923 - 3414146
Alignment:
| Q |
1 |
atttaccatgaaggagtattaagagatatatgtttaatttagctcaaactagtctnnnnnnncctagtttaaatagaccctttcaagtttttcagacaga |
100 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |||| || |
|
|
| T |
3413923 |
atttaacatgaaggagtattgagagatatatgtttaatttagctcaaactagtccaaaaaaacctagttgaaatagaccctttcaggtttttgagaccga |
3414022 |
T |
|
| Q |
101 |
aacatgccaagaacgcgagtgtggcggcgattcaaacacaccaacgaccaacccataacaatccacaccaatcaatatgacgcatgaagccacacccaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
3414023 |
aacatgccaagaacgcgagtgtggcggcgattcaaacacaccaacgaccaacccataacaatccacaccaatcaatatgacgcatgaagccataaccaga |
3414122 |
T |
|
| Q |
201 |
aagctaacacaatgaacaatttaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3414123 |
aagctaacacaatgaacaatttaa |
3414146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University