View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_high_47 (Length: 230)
Name: NF9884_high_47
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 24143938 - 24143717
Alignment:
| Q |
1 |
caagacaatagcttcacattttaatttccaaacatgtaacaaaccatgttgtgtaattccactttacctagtgttcttgctgga-ggtgggtcccgcaac |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
24143938 |
caagacaatagcgtcacattttaatttccaaacatgtaacaaaccatgttgtgtaattccactttccctagtgttcttgctggaaggtgggtcccgcaaa |
24143839 |
T |
 |
| Q |
100 |
ctttcacttgctctttcacgttggtctacaagtaacaaacttgtcttatatatatacatacataagatactaatgttggcaaaatcaagttaaacatgtc |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24143838 |
ctttcacttgctctttcacgttggtttacaagtaacaaacttgtcttatatata--catacataagatactaatgttggcaaaatcaagttaaacatgtc |
24143741 |
T |
 |
| Q |
200 |
tagcaacatggctgttatcactgg |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24143740 |
tagcaacatggctgttatcactgg |
24143717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University