View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_33 (Length: 266)
Name: NF9884_low_33
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 35197918 - 35197670
Alignment:
| Q |
1 |
tagaaagttttcttatccaatatatacactttaatttacaaagttgatttttcttctttctattgctatcaattgacaacaacaagacagaagtaccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
35197918 |
tagaaagttttcttatccaatatatacactttaatttacaaagttgatgtttcttctttctattgccatcaattgacaacaacaagacagaagtatcgga |
35197819 |
T |
 |
| Q |
101 |
aattttcagcattacactcacacaattagtacttcgataaccgttggattaagaccaaatggttcacaatctataatatatataagcaattagatcttga |
200 |
Q |
| |
|
| | |||||||| ||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35197818 |
ttgagatatc-ttacactcgcacaattagtacttcgataactgttggatcaagatcaaatggttcacaatctataatatatataagcaattagatcttaa |
35197720 |
T |
 |
| Q |
201 |
tctgacggtcatcgatgtacttattgagtgaatattgaatatcccaattg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35197719 |
tctgacggtcatcgatgtacttattgagtgaatgttgaatatcccaattg |
35197670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University