View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_35 (Length: 260)
Name: NF9884_low_35
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 3 - 251
Target Start/End: Complemental strand, 3413907 - 3413659
Alignment:
| Q |
3 |
catactactttgtataactctctaaaccaaatatttatctagcctctctctaaccttcaccctccattgtacttatctaccctaaaatccaaatatctag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3413907 |
catactactttgtataactctctaaaccaaatatttatctagcctctctctaaccttcatcctccattgtacttatctaccctaaaatccaaatatctag |
3413808 |
T |
 |
| Q |
103 |
ttcaggatataacctcattgggttgtggtgcgactataccgtcttttgcaccactgtgtcaccctattgcggttgcttttattccttccatttagacggc |
202 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3413807 |
ttcaggatatagcctcattgggttgtggtgcgactataccgtcttttgcaccactgtgtcatcctattgcggttgcttttattccttccatttcgacggt |
3413708 |
T |
 |
| Q |
203 |
cgtccattcaaacgctctcttaacctatttccatcaatgttgttcttat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3413707 |
cgtccattcaaacgctctcttaacctatttccatcaatgttgttcttat |
3413659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University