View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_36 (Length: 257)
Name: NF9884_low_36
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 32214924 - 32214685
Alignment:
| Q |
2 |
agatgaaattgttaagtgaaatctcatacaattttctataactgacatgctccctaacacaagagaccttcaagcttggatgtataggcattgcaggtgt |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214924 |
agatgaaattgttaagcgaaatctcatacaattttctataactggcatgctccctaacacaagagaccttcaagcttggatgtataggcattgcaggtgt |
32214825 |
T |
|
| Q |
102 |
caactttatctttgctgaaatataagcttttttcagaagtatggcggtgtcaattagcttaaccagggatcaagagcacaactcttttagtcaccattct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214824 |
caactttatctttgctgaaatataagcttttttcagaagtatggcggtgtcaattagctttactagggatcaagagcacaactcttttagtcaccattct |
32214725 |
T |
|
| Q |
202 |
tctaattacagttaattttcagctcttgataaaaatttcc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214724 |
tctaattacagttaattttcagctcttgataaaaatttcc |
32214685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University