View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_41 (Length: 250)
Name: NF9884_low_41
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 153 - 240
Target Start/End: Original strand, 24144176 - 24144263
Alignment:
| Q |
153 |
gttatttaagaagtattatttttaaatgagaaatcgaactaatattattgaggttattatacaacctttctaagttacacatcctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24144176 |
gttatttaagaagtattatttttaagtgaaaaatcgaactaatattattgaggttattatacaacctttctaagttacacatcttttg |
24144263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 24143988 - 24144029
Alignment:
| Q |
1 |
caagacggatttgaacctggtgtgaatttcgtggctcgattt |
42 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24143988 |
caagacggatttgaacccagtgtgaatttcgtggctcgattt |
24144029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University