View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_43 (Length: 248)
Name: NF9884_low_43
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 40330893 - 40330705
Alignment:
| Q |
18 |
ataattagacatagtatagcagccatatttaagcaacacgcattctttctaatgatcaatggctatttaggaaacacacgtaaatcaaactgcatttgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40330893 |
ataattagacatagtatagcagccatatttaagcaacacacattctttctaatgat--------atttaggaaacacacgtaaatcaaactgcatttgca |
40330802 |
T |
|
| Q |
118 |
aaccaaatcccttatgatggacctcatgatgtggttaaatccattgtccatgcatgtttcccacaccttcaagtgccatatgctgttgctgttgatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40330801 |
aaccaaatcccttatgatggacctcatgatgtggttaaatccattgtccatgcatgtttcccacaccttcaagtgccatatgctgttgctgttgatc |
40330705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University