View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_53 (Length: 237)
Name: NF9884_low_53
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 3683417 - 3683211
Alignment:
| Q |
19 |
tatattttatttagcttttgctcgaacaaagattagtctagtgaccccttttctcnnnnnnnnn--ttaggacaatgtgcaattgatgatgggaaaataa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3683417 |
tatattttatttagcttttgctcgaacaaagattagtctagtgaccccttttctcaaaaaaaaaaattaggacaatgtgcaattgatgatgggaaaataa |
3683318 |
T |
|
| Q |
117 |
taaacgtaccagagcaagtcttgctaacggtgagcttgtatacaaggactataaggccaataatatggattgatccagaggctatgtagaaaaaatgagg |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683317 |
taaacgtaccagagcaagtcttgttaacgatgagcttgtatacaaggactacaaggccaataatatggattgatccagaggctatgtagaaaaaatgagg |
3683218 |
T |
|
| Q |
217 |
gtctgtg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
3683217 |
gtctgtg |
3683211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 3661482 - 3661419
Alignment:
| Q |
149 |
agcttgtatacaaggactataaggccaataatatggattgatccagaggctatgtagaaaaaat |
212 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| || | |||||||| || ||||||||| |
|
|
| T |
3661482 |
agcttgtatatgaggacaataaggccaataatatggactgtttcagaggctttgaagaaaaaat |
3661419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University