View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9884_low_60 (Length: 213)
Name: NF9884_low_60
Description: NF9884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9884_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 35651810 - 35651636
Alignment:
| Q |
12 |
agagaggaaaattaaaagcaacaaagatacaaactttgtttctaaattatttctaaattatttttgtagaactagtttgtgtcactaagcaattttcgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35651810 |
agagaggaaaattaaaagcaacaaagatacaaactttgtttctaaattattttta-----------tagaa-tagtttgtgtcactaagcaattttcgtt |
35651723 |
T |
 |
| Q |
112 |
tttaatttaatgttgggacggaaaagtgagattggaagatgatggaataaggaacgtttgaagcagtactgggaatggaaaagaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35651722 |
tttaatttaatgttgggacggaaaagtgagattggaagatgatggaataaggaatgtttgaagcagtactgggaatgaaaaagaaac |
35651636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University