View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9885_high_2 (Length: 395)
Name: NF9885_high_2
Description: NF9885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9885_high_2 |
 |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0330 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 6439 - 6191
Alignment:
| Q |
19 |
gatatttcataaacctctttactcatcaaaattgaggctcttttctcacttttatttaatttgtgttgttttttcttgacaactactcactaatcttgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6439 |
gatatttcataaacctctttactcatcaaaattgaggctcttttctcacttttatttaatttgtgttgttttttcttgacaactactctagtatcttgga |
6340 |
T |
 |
| Q |
119 |
ttactatggattgttacaaattaccannnnnnnnctttaaaaatttgagttgttttgttgtcggcaaaggtgttaaaaacatatttggaatggattttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6339 |
ttactatggattgttacaaattaccattttttttctttaaaaatttgagttgttttgttgtcggcaaaggtgttgaaaacatatttggaatggattttaa |
6240 |
T |
 |
| Q |
219 |
tgtggaattagtcttgtaattccaatatttgagggtatataagatatta |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6239 |
tgtggaattagtcttgtaattccaatatttgagggtatatatgatatta |
6191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University