View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9885_low_5 (Length: 290)
Name: NF9885_low_5
Description: NF9885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9885_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 158 - 280
Target Start/End: Complemental strand, 46546949 - 46546828
Alignment:
| Q |
158 |
ctttcccacattgtagctcctccataaagaaattccaggctgacatggattccaaaatgatcnnnnnnnttcaacttaatactcttaaaccatatattaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
46546949 |
ctttcccacattgtagctcctccataaagaaattctaggctgacatggattccaaaatgatcaaaaaaattcaac-taatactcttaaaccatatattaa |
46546851 |
T |
|
| Q |
258 |
gatatggtgattgacaacctatg |
280 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46546850 |
gatatggtgattgacaacctatg |
46546828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 46547087 - 46547030
Alignment:
| Q |
18 |
agatataaagggcgagaatatctccaataatatttatcgacttctagctacggctcgt |
75 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46547087 |
agatataaaggacgagaatatctccaataatatttatcgacttctagctacggctcgt |
46547030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University