View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9885_low_6 (Length: 255)
Name: NF9885_low_6
Description: NF9885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9885_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 45596609 - 45596377
Alignment:
| Q |
5 |
caccctcctgtcaaaaaataaagagaaattatgaaaatgaattgtagaagcccacgttgagaaatattttgacacgttacacagttcgttcaagttcagc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596609 |
caccctcctgtcaaaaaataaagagaaattatgaaaatgaattgtagaagcccacgttgagaaatattttgacacgttacacagttcgttcaagttcagc |
45596510 |
T |
|
| Q |
105 |
tgataaatgaaactcgtcaacactatacaccttaaccaataaacattcattgccgatagtattgacttgtcttt------------tctctccaatccac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| || |
|
|
| T |
45596509 |
tgataaatgaaactcgtcaacactatacaccttaaccaataaacattcattgccgatagtattgtcttgtcttttctcatcacttctctctccaatctac |
45596410 |
T |
|
| Q |
193 |
cgcttcaaaaagttttcccacaacttcgcctga |
225 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45596409 |
cgcttcaaaaagttttcacacaacttcacctga |
45596377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University