View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9885_low_9 (Length: 247)
Name: NF9885_low_9
Description: NF9885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9885_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 9559943 - 9560144
Alignment:
| Q |
1 |
ttcgtttttctagcaaatatgtaagctaaggatagaaaaatttcctcattggaaatattaaaatatcaatggacatgaagtggatggtgttccatgtg-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9559943 |
ttcgtttttctagcaaatatgtaagctaaggatagaaaaatttctacattggaaatgttaaaatatcaatgggcatgaagtggatggtgttccatgtgtg |
9560042 |
T |
|
| Q |
99 |
tctcagtatagctctttgcaggatcagtatgtagatcagaagatccagtactgctatgatttatcatttgctgactgctaggatcagtatctttagagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9560043 |
tctcagtatagctctttgcaggatcagtatgtagatcagaagatccagtactgctatgatttatcatttgcttactgctaggatcagtatctttagagtt |
9560142 |
T |
|
| Q |
199 |
gg |
200 |
Q |
| |
|
|| |
|
|
| T |
9560143 |
gg |
9560144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 9560182 - 9560226
Alignment:
| Q |
197 |
ttggttcagacttcagatgcaagcatattcaatagccccctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
9560182 |
ttggttcagacttcagatgcaagcaaattcaatagccccttatgc |
9560226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 230
Target Start/End: Original strand, 19789545 - 19789578
Alignment:
| Q |
197 |
ttggttcagacttcagatgcaagcatattcaata |
230 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
19789545 |
ttggttcagacttcaaatgcaagcatattcaata |
19789578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University