View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9885_low_9 (Length: 247)

Name: NF9885_low_9
Description: NF9885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9885_low_9
NF9885_low_9
[»] chr8 (2 HSPs)
chr8 (1-200)||(9559943-9560144)
chr8 (197-241)||(9560182-9560226)
[»] chr1 (1 HSPs)
chr1 (197-230)||(19789545-19789578)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 9559943 - 9560144
Alignment:
1 ttcgtttttctagcaaatatgtaagctaaggatagaaaaatttcctcattggaaatattaaaatatcaatggacatgaagtggatggtgttccatgtg-- 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||  |||||||||| ||||||||||||||| |||||||||||||||||||||||||      
9559943 ttcgtttttctagcaaatatgtaagctaaggatagaaaaatttctacattggaaatgttaaaatatcaatgggcatgaagtggatggtgttccatgtgtg 9560042  T
99 tctcagtatagctctttgcaggatcagtatgtagatcagaagatccagtactgctatgatttatcatttgctgactgctaggatcagtatctttagagtt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
9560043 tctcagtatagctctttgcaggatcagtatgtagatcagaagatccagtactgctatgatttatcatttgcttactgctaggatcagtatctttagagtt 9560142  T
199 gg 200  Q
    ||    
9560143 gg 9560144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 9560182 - 9560226
Alignment:
197 ttggttcagacttcagatgcaagcatattcaatagccccctatgc 241  Q
    ||||||||||||||||||||||||| ||||||||||||| |||||    
9560182 ttggttcagacttcagatgcaagcaaattcaatagccccttatgc 9560226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 230
Target Start/End: Original strand, 19789545 - 19789578
Alignment:
197 ttggttcagacttcagatgcaagcatattcaata 230  Q
    ||||||||||||||| ||||||||||||||||||    
19789545 ttggttcagacttcaaatgcaagcatattcaata 19789578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University