View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9886_high_6 (Length: 258)
Name: NF9886_high_6
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9886_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 199
Target Start/End: Original strand, 14511547 - 14511744
Alignment:
| Q |
7 |
gagagccagcagaggaagattatcatgaatctaaaaatagtattttatcttcgattaaccaaaagataaagtttaattatgctgtgt-catgcactttgt |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14511547 |
gagagccaacagaggaagattatcatgaatctaaaaatagtattttatcttcgattaaccaaaagataaagtttaattatgctgtgtccatgcactttgt |
14511646 |
T |
 |
| Q |
106 |
tccaattcaaccaatgt----ttatagtccatggcgaatcttcataacacatataaatagttgtagcaaaatcgccacgcgagagaagttcacgctaa |
199 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
14511647 |
tccaattcaaccaatgtaacattacagtccatggagaatcctcgtaacacatataaatagttgtagcaaaattgccacgcgagagaagttcacactaa |
14511744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University