View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9886_high_8 (Length: 241)
Name: NF9886_high_8
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9886_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 12646969 - 12647193
Alignment:
| Q |
1 |
atggggtcgtttgactttatcaattagatattttttgtaacaaacttatcttcatttgactttagcaaatagacatccttagagggagtatcctctatct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
12646969 |
atggggtcgtttgactttatcaatgagatattttttgtaacaaacttaccttcatttgactttagcaaagagacatccttagagggagtatcatctatct |
12647068 |
T |
|
| Q |
101 |
atgatttcaatcggaggaagttggagacaaaattggtggtattaaatgggtatgttgctttcatttgtactgtcctcaagactgcttattttcacatatg |
200 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||| | ||||||||| |
|
|
| T |
12647069 |
atgatttcaatcgcagaaagttggagaaaaaattggtggtattaaatgggtctgttgctttcatttgtactgtcctcatgacttcttttagtcacatatg |
12647168 |
T |
|
| Q |
201 |
ggttttgggtgaaattggtgttaag |
225 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
12647169 |
ggttttgggtgaacatggtgttaag |
12647193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 12652095 - 12652304
Alignment:
| Q |
1 |
atggggtcgtttgactttatcaattagatattttttgtaacaaacttatcttcatttgactttagcaaatagacatccttagagggagtatcctctatct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||| | ||||||||| | |||||| |
|
|
| T |
12652095 |
atggggtcgtttgactttatcaatgagatattttttgtaacaaacttaccttcgtttgactttagcaaagacacatcctta--------accctcta--- |
12652183 |
T |
|
| Q |
101 |
atgatttcaatcggaggaagttggagacaaaattggtggtattaaatgggtatgttgctttcatttgtactgtcctcaagactgcttattttcacatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12652184 |
-tgatttcaatcggaggaagttggagacaaaattggtggtattaaatgggtatgttgctttcatttgtactgtcctcaagactgcttattttcacatatc |
12652282 |
T |
|
| Q |
201 |
ggttttgggtgaaattggtgtt |
222 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
12652283 |
gattttgggtgaaattggtgtt |
12652304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University