View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9886_low_16 (Length: 219)
Name: NF9886_low_16
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9886_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 41719168 - 41719357
Alignment:
| Q |
14 |
cacagaacaatggtatgaaccttctcaccccaaaaaactgacaaatcccaacgttggcagtaacagaaccctgaaagaacattaaactcatgttatgtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41719168 |
cacagaacaatggtatgaaccttctcaccccaaaaaactgacaaatcccaacgttggcagtaacagaaccctgaaagaacattaaactcatgttatgtaa |
41719267 |
T |
 |
| Q |
114 |
gatcacggtgtaaattaggaacactagaattaatcagcagatagattctcagctttactcttattttcatttttatctttcgtaatatat |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41719268 |
gatcacggtgtaaattaggaactctagaattaatcagcagatagattctcagctttactcttattttcatttttatctttcgtaatatat |
41719357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University