View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9886_low_8 (Length: 341)
Name: NF9886_low_8
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9886_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 144 - 223
Target Start/End: Original strand, 30654067 - 30654146
Alignment:
| Q |
144 |
gatggcttcttgggagtctatgctgagattttcgatacaattatgtctagtttttctgcatctgctttggaatctcgact |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| | |||||||||| |
|
|
| T |
30654067 |
gatggcttgttgggagtctatgctgagattttcgatacaattctgtctagtttttctgcctctgctgcgcaatctcgact |
30654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 10868751 - 10868817
Alignment:
| Q |
21 |
tgtagggatgatatatatgtagtataatccagcttcaattttgtgagttatgtgattagaactataa |
87 |
Q |
| |
|
||||||| || |||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10868751 |
tgtagggctggtatatatgcaatataatccagcttcagttttgtgagttatgtgattagaactataa |
10868817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 247 - 321
Target Start/End: Original strand, 30654160 - 30654233
Alignment:
| Q |
247 |
atagcttttagcatgttgcaaactttttgttagttgcctccagatgtgattagatgcctactgttttggagtttg |
321 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
30654160 |
atagcttttggcatgttgcactcttttc-ttagttgcctccaaatgtgattagatgcctacagttttggggtttg |
30654233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University