View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9886_low_8 (Length: 341)

Name: NF9886_low_8

Description: NF9886

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF9886_low_8

[»] chr5 (3 HSPs)

Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 3)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 56; E-Value: 4e-23

Query Start/End: Original strand, 144 - 223

Target Start/End: Original strand, 30654067 - 30654146

Alignment:

Q	144	gatggcttcttgggagtctatgctgagattttcgatacaattatgtctagtttttctgcatctgctttggaatctcgact	223	Q
		\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|
T	30654067	gatggcttgttgggagtctatgctgagattttcgatacaattctgtctagtttttctgcctctgctgcgcaatctcgact	30654146	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2

Raw Score: 47; E-Value: 8e-18

Query Start/End: Original strand, 21 - 87

Target Start/End: Original strand, 10868751 - 10868817

Alignment:

Q	21	tgtagggatgatatatatgtagtataatccagcttcaattttgtgagttatgtgattagaactataa	87	Q
		\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	10868751	tgtagggctggtatatatgcaatataatccagcttcagttttgtgagttatgtgattagaactataa	10868817	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3

Raw Score: 39; E-Value: 0.0000000000005

Query Start/End: Original strand, 247 - 321

Target Start/End: Original strand, 30654160 - 30654233

Alignment:

Q	247	atagcttttagcatgttgcaaactttttgttagttgcctccagatgtgattagatgcctactgttttggagtttg	321	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|
T	30654160	atagcttttggcatgttgcactcttttc-ttagttgcctccaaatgtgattagatgcctacagttttggggtttg	30654233	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]