View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9886_low_9 (Length: 328)

Name: NF9886_low_9
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9886_low_9
NF9886_low_9
[»] chr6 (3 HSPs)
chr6 (182-313)||(10022768-10022899)
chr6 (82-171)||(10022633-10022722)
chr6 (15-55)||(10022544-10022584)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 182 - 313
Target Start/End: Original strand, 10022768 - 10022899
Alignment:
182 attagcagaatacacttgcactaaggaacattcagagaacaatattctagcagttttaggttttgaaaatacatatcactagatggaccttaatagtgct 281  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||    
10022768 attagcagaatacacttgcactaaggaacatttagagaacaatattctaacagttttaggttttggaaatacatatcactagatagaccttaatagtgct 10022867  T
282 taaaatgtcacatggtgagatcatgagacagc 313  Q
    ||||| ||||| ||||||||||||||||||||    
10022868 taaaacgtcacgtggtgagatcatgagacagc 10022899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 82 - 171
Target Start/End: Original strand, 10022633 - 10022722
Alignment:
82 gttatgtaatcaattccattttctcaaattattaccggtattggcgagtcagtgtcatgtctagtttccgtgactatgtcatgatttcgt 171  Q
    |||||||||||| |||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||| |||||    
10022633 gttatgtaatcacttccatattctcaaattattaccggtattagcgtgtcagtgtcatgtctagtttccgtgattatgtcatgacttcgt 10022722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 55
Target Start/End: Original strand, 10022544 - 10022584
Alignment:
15 aaagttcatggaatgtttacagaaactatttttgaagttct 55  Q
    ||||||||||||||||||||||||||  | |||||||||||    
10022544 aaagttcatggaatgtttacagaaaccgtctttgaagttct 10022584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University