View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9886_low_9 (Length: 328)
Name: NF9886_low_9
Description: NF9886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9886_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 182 - 313
Target Start/End: Original strand, 10022768 - 10022899
Alignment:
| Q |
182 |
attagcagaatacacttgcactaaggaacattcagagaacaatattctagcagttttaggttttgaaaatacatatcactagatggaccttaatagtgct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
10022768 |
attagcagaatacacttgcactaaggaacatttagagaacaatattctaacagttttaggttttggaaatacatatcactagatagaccttaatagtgct |
10022867 |
T |
|
| Q |
282 |
taaaatgtcacatggtgagatcatgagacagc |
313 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |
|
|
| T |
10022868 |
taaaacgtcacgtggtgagatcatgagacagc |
10022899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 82 - 171
Target Start/End: Original strand, 10022633 - 10022722
Alignment:
| Q |
82 |
gttatgtaatcaattccattttctcaaattattaccggtattggcgagtcagtgtcatgtctagtttccgtgactatgtcatgatttcgt |
171 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10022633 |
gttatgtaatcacttccatattctcaaattattaccggtattagcgtgtcagtgtcatgtctagtttccgtgattatgtcatgacttcgt |
10022722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 55
Target Start/End: Original strand, 10022544 - 10022584
Alignment:
| Q |
15 |
aaagttcatggaatgtttacagaaactatttttgaagttct |
55 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
10022544 |
aaagttcatggaatgtttacagaaaccgtctttgaagttct |
10022584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University