View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9887_low_6 (Length: 208)
Name: NF9887_low_6
Description: NF9887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9887_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 194
Target Start/End: Original strand, 31980990 - 31981156
Alignment:
| Q |
24 |
tgtttgtagtagctatggctttagtgaggtggtagtacataatgaataacacataagaagtgttgatttaaagaacaagttaaagtaattaatataaatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
31980990 |
tgtttgtagtagctatggctttagtgaggtggtagtacataatgaataacacataagaagtgttggtttaaagaacaagttaaactaattaatataaatt |
31981089 |
T |
|
| Q |
124 |
gaagagttgaatgaattaaacaaactgaagctacaaagtatgttgtatgaatgaactataaagtatggatt |
194 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31981090 |
gaagagttgaatggattaaacaaactgaagctacaaagtatgttgt----atgaactataaagtatggatt |
31981156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University