View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9888_high_15 (Length: 231)
Name: NF9888_high_15
Description: NF9888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9888_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 142 - 218
Target Start/End: Original strand, 39306025 - 39306101
Alignment:
| Q |
142 |
ggaacaaatattgatcaattaattgaccatatatgttgaatttaaatatgcaaaagatccttgcaattacggcccct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39306025 |
ggaacaaatattgatcaattaattgaccatatatgttgaatttaaatatgcaaaagatccttgcaattatggcccct |
39306101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 126
Target Start/End: Original strand, 39305326 - 39305442
Alignment:
| Q |
5 |
aataatgtgtagcatgcagtggcagaagacaaagttgtttgttagtttaaggaaggtgatgctaattccannnnnnnnccatggggcgatggtcagcagg |
104 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| | ||||||||||||||||||||||||||||||| ||||||||||||| |||| || |
|
|
| T |
39305326 |
aataatgtgtagcatgtagtggcaaaagacaa----ggatgttagtttaaggaaggtgatgctaattccatttttttt-catggggcgatggccagctgg |
39305420 |
T |
|
| Q |
105 |
aagagaattaatttcctcaact |
126 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
39305421 |
aagagaattaatttcctaaact |
39305442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 33357469 - 33357421
Alignment:
| Q |
165 |
tgaccatatatgttgaatttaaatatgcaaaagatccttgcaattacgg |
213 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||| ||||||| |||| |
|
|
| T |
33357469 |
tgaccatatatattggacttaaatatgcaaaagatctttgcaataacgg |
33357421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University