View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9888_low_13 (Length: 240)
Name: NF9888_low_13
Description: NF9888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9888_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 218
Target Start/End: Complemental strand, 23784826 - 23784617
Alignment:
| Q |
9 |
aagcagagaagaataatcaaccctgcgtttcacatggaaaaattgaaggttatcttcttttttcatttatcttttgcaccgctcgtgtggtaaaatttgt |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23784826 |
aagcatagaagaataatcaaccctgcgtttcacatggaaaaattgaaggttatcttcttttttcatttatcttttgcactactcgtgtggtaaaatttgt |
23784727 |
T |
|
| Q |
109 |
ttttgattaaccaagcaattgagcttaagtggttaatgaactttactatagacgaatcgttcaagggaacccgccttcgattcataggtagaacaatttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||| | |||||||||||||||||| |||| |
|
|
| T |
23784726 |
ttttgattaaccaagcaattgagcttaagtggttaatgagctttactaaagacgaatcgttcaacggaacccacgttcgattcataggtagaaatttttt |
23784627 |
T |
|
| Q |
209 |
ttgttaggtg |
218 |
Q |
| |
|
|||| ||||| |
|
|
| T |
23784626 |
ttgtcaggtg |
23784617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 23767301 - 23767353
Alignment:
| Q |
9 |
aagcagagaagaataatcaaccctgcgtttcacatggaaaaattgaaggttat |
61 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23767301 |
aagcatagaaggataatcaaccctgcttttcacatggaaaaattgaaggttat |
23767353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 212
Target Start/End: Original strand, 38021439 - 38021537
Alignment:
| Q |
114 |
attaaccaagcaattgagcttaagtggttaatgaactttactatagacgaatcgttcaagggaacccgccttcgattcataggtagaacaattttttgt |
212 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| | |||| |||| || || ||||| | |||||||| ||||||||||| || ||||| |
|
|
| T |
38021439 |
attaaccaagcaattgagctcaaatggttaatgaactttacgaaagacaaatcatttgagagaacctgagttcgattcctaggtagaacatttgtttgt |
38021537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 148
Target Start/End: Complemental strand, 33498058 - 33498017
Alignment:
| Q |
107 |
gtttttgattaaccaagcaattgagcttaagtggttaatgaa |
148 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33498058 |
gttttagattaaccaaacaattgagcttaagtggttaatgaa |
33498017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 155
Target Start/End: Complemental strand, 10449229 - 10449186
Alignment:
| Q |
112 |
tgattaaccaagcaattgagcttaagtggttaatgaactttact |
155 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10449229 |
tgataaaccaaacaattgagtttaagtggttaatgaactttact |
10449186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 169
Target Start/End: Complemental strand, 24863065 - 24863009
Alignment:
| Q |
114 |
attaaccaagcaattgagcttaagtggttaatgaacttta-ctatagacgaatcgtt |
169 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| | || | |||||||||||||| |
|
|
| T |
24863065 |
attaaccaaacaattgaacttaagtggttaatgaattatatcaatagacgaatcgtt |
24863009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 150
Target Start/End: Complemental strand, 37064158 - 37064124
Alignment:
| Q |
116 |
taaccaagcaattgagcttaagtggttaatgaact |
150 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
37064158 |
taaccaagcaattgagctgaagtggttaatgaact |
37064124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University