View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9889_high_18 (Length: 322)
Name: NF9889_high_18
Description: NF9889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9889_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 6 - 297
Target Start/End: Original strand, 4834297 - 4834589
Alignment:
| Q |
6 |
actcttcaccttataaatatggaaaacattaccccctaagtgttgtatttgtgtctagattgtgcgtgcaaatagcaattt-caagcaaatttaagtttg |
104 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4834297 |
actcttcaccttataaatatggagaacactaccccctaagtgttgtatttgtgtctagattgtgcgtgcaaatagcaattttcaagcaaatttaagtttg |
4834396 |
T |
 |
| Q |
105 |
gaaggtgtgataaccaaaatggacaaattttcctgagtgaagttttgatccttaatattgtggaggaatgaggatcgttatcaaatgcagccaatgtcgc |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4834397 |
gaaggtttgataaccaaaatggacaaattttcctgagtgaagttttgatccttaatattgtggaggaatgaggatcgttatcaaatgcagccaatgtcgc |
4834496 |
T |
 |
| Q |
205 |
ctcaatcgtgactgccttgtagcttcaacaacatcgaaaaccgttataacacggctgagactgcggtcacaaacctttgtttacaaccgatag |
297 |
Q |
| |
|
|| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4834497 |
cttaatcgtgactgccctgtagtttcaacaacatcgaaaaccgttataacacggctgagactgcggtcacaaacctttgtttacaactgatag |
4834589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University