View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9889_low_21 (Length: 340)

Name: NF9889_low_21
Description: NF9889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9889_low_21
NF9889_low_21
[»] chr8 (2 HSPs)
chr8 (247-332)||(1248448-1248533)
chr8 (56-134)||(1248044-1248124)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 247 - 332
Target Start/End: Original strand, 1248448 - 1248533
Alignment:
247 agtcctaaagtccaaaacaacgtgacctacaaaagccggtctctttcatatatttttggagttaatgcacagttctttcctttgct 332  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||    
1248448 agtcctaaagtccaaaacaacatgacctacaaaagccggtctctttcatatatttttagagttaatgcgcagttctttcctttgct 1248533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 56 - 134
Target Start/End: Original strand, 1248044 - 1248124
Alignment:
56 cttttggtttcacatagattttctctaccagagataatcttattcgagatgtg--gtggtgactaaatatagatatctctt 134  Q
    ||||||||||||||||||||||||||| |||||||||||||| ||||||||||  | | ||||||||||||||||||||||    
1248044 cttttggtttcacatagattttctctatcagagataatcttaatcgagatgtgccgcgatgactaaatatagatatctctt 1248124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University