View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9889_low_24 (Length: 311)
Name: NF9889_low_24
Description: NF9889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9889_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 3961807 - 3961524
Alignment:
| Q |
18 |
gtatgagggtgtgggggacgattcttgatgttcaacccaaggtagctagcgtggcttctcatgttgaattattgatagaaaaagagaaagatacggtgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961807 |
gtatgagggtgtgggggacgattcttgatgttcaaccaaaggtagctagcgtggcttctcatgttgaattattgatagaaaaagagaaagatacggtgaa |
3961708 |
T |
|
| Q |
118 |
atgttgatttaacaagttttggcatatctgtttacgtacgatcgaatatctactattgcatgttgttattatatgcattttgatgtagagccaaattcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961707 |
atgttgatttaacaagttttggcatatctgtttacgtacgatcgaatatctactattgcatgttgttattatatgcattttgatgtagagccaaattcaa |
3961608 |
T |
|
| Q |
218 |
tccagcaaagtagccagctagctccattccttcaatccattatttgccatattggaccacattcattgtgttttagatcctttg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961607 |
tccagcaaagtagccagctagctccattccttcaatccattatttgctatattggaccacattcattgtgttttagatcctttg |
3961524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University