View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9889_low_31 (Length: 248)
Name: NF9889_low_31
Description: NF9889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9889_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 2 - 242
Target Start/End: Original strand, 5563247 - 5563487
Alignment:
| Q |
2 |
ataagggttgaatataatagatggctataatttggacacattttgagtataaaatgttcataagcttcacgtttatatcaatataaattgactattagag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5563247 |
ataagggttgaatataatagatggctataatttggacacattttgagcataaaatgttcataagcttcaagtttatatcaacataaattgactattagag |
5563346 |
T |
 |
| Q |
102 |
accaacaatgaaatgtgggtttctcatgtcattgttcagtcacactatatacgttttgactcaatcctgaggtcttgtcaacccacatattgagttaata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5563347 |
accaacaatgaaatgtgggtttctcatgtcattgttcaatcacactatatacgttttgactcaatcctgaggtcttgtcgacccacatcttgagttaata |
5563446 |
T |
 |
| Q |
202 |
accttaagaaagaattgaatcaatcccttggttctctgctt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5563447 |
accttaagaaagaattgaatcaatcccttggttgtctgctt |
5563487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University