View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9890_high_1 (Length: 361)
Name: NF9890_high_1
Description: NF9890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9890_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 181 - 355
Target Start/End: Complemental strand, 39940157 - 39939983
Alignment:
| Q |
181 |
tgatcgatattcgccggagtgagtttgcgtgcggtgagttctcatgatctatcgatgatttgattctttctctgattcttctgcgccaccgcaaagttta |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39940157 |
tgatcgatattcgccggagtgagtttgcgtgcggtgagttctcatgatctatcgatgatttgattctttctctgattcttctgcgccaccgcaaaattta |
39940058 |
T |
 |
| Q |
281 |
cgctctagatcttgtactcacgtgctttacgtgtgatgatcgatattcttcgtcttgttatgcctcctttgcttc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39940057 |
cgctctagatcttgtactcacgtgctttgcgtgtgatgatcgatattcttcgtcttgttatgcctcgtttgcttc |
39939983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 24 - 119
Target Start/End: Complemental strand, 39940314 - 39940219
Alignment:
| Q |
24 |
acaagtaaataaaattatccttaaacataaaccctaaataacgaaccttatcggagaaggtgtcggaagttaaagtgatgacttcggaattggtgg |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39940314 |
acaagtaaatacaattatccttaaacataaaccctaaataacaaaccttatcggagaaggtgtcggaagttaaagtgatgacttcggaattggtgg |
39940219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University