View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9891_low_1 (Length: 323)
Name: NF9891_low_1
Description: NF9891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9891_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 21 - 304
Target Start/End: Complemental strand, 43711576 - 43711293
Alignment:
| Q |
21 |
tttgactctatcactttattccttctttctctcattttcactcaaattacaacacccacatgaacacacataaacnnnnnnncaacactctcaaatctga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43711576 |
tttgactctatcactttattccttctttctctcattttcactcaaattacaacacccacatgaacacacataaacaaaaaaacaacactctcaaatctga |
43711477 |
T |
|
| Q |
121 |
cagagaactacagttttgcatttaatatccccatgtttcagactatttacacttcattttcctcaccttcatattcagtctttgatttttacaagctttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43711476 |
cagagaactacagttttgcatttaatatccccatgtttcagactatttacacttcattttcctcaccttcatattcagtctttgatttttacaagctttt |
43711377 |
T |
|
| Q |
221 |
gcaacacaatggttctacatagtagaaaacttcaaacttcattgcttttattgctcttgtttctctgcatatttggtcactgtg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43711376 |
gcaacacaatggttctacatagtagaaaacttcaaacttcattgcttttattgctcttgtttctctgcatatttggtcactgtg |
43711293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University