View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9891_low_6 (Length: 221)

Name: NF9891_low_6
Description: NF9891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9891_low_6
NF9891_low_6
[»] chr2 (1 HSPs)
chr2 (1-145)||(33655264-33655408)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 33655264 - 33655408
Alignment:
1 tttgagcccttccatcggatgatggtgtttgaactgatgctggcaagctataatctgcaattttcaaaatcaataagagtaacaaacttctggagctaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33655264 tttgagcccttccatcggatgatggtgtttgaactgatgctggcaagctataatctgcaattttcaaaatcaataagagtaacaaacttctggagctaac 33655363  T
101 tgtacaagatattgatgcaagagggttttattggtagtttagtag 145  Q
    ||||||||||||||||||| |||||||||||||||| ||||||||    
33655364 tgtacaagatattgatgcaggagggttttattggtaatttagtag 33655408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University