View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_15 (Length: 389)
Name: NF9893_high_15
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 231 - 371
Target Start/End: Original strand, 2245084 - 2245225
Alignment:
| Q |
231 |
attaaccgtctcgtggtcgaggaccctatagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat |
330 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245084 |
attaaccgtctcgtggtcgaggaccctttagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat |
2245183 |
T |
|
| Q |
331 |
tcgttgtctgataagcaactatgctcttc-ttgttgctaact |
371 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2245184 |
tcgttgtctgataagcaactatgctcttctttgttgctaact |
2245225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 192
Target Start/End: Original strand, 2245013 - 2245041
Alignment:
| Q |
164 |
tgtttaaccgaacaaattaaacaagttac |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2245013 |
tgtttaaccgaacaaattaaacaagttac |
2245041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University