View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_26 (Length: 344)
Name: NF9893_high_26
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 34713345 - 34713405
Alignment:
| Q |
2 |
aagattttccgtccattgtcaaactaggaataacatagnnnnnnngaagttaataacatat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34713345 |
aagattttccgtccattgtcaaactaggaataacatagaaaaaaagaagttaataacatat |
34713405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University