View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_45 (Length: 248)
Name: NF9893_high_45
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 29175226 - 29175007
Alignment:
| Q |
12 |
caaaggaggtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtcttataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29175226 |
caaaggaggtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtcttataa |
29175127 |
T |
|
| Q |
112 |
gttatataactcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagtgtggctcaggctagcgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29175126 |
gttatataactcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagcgtggctcaggctagcgt |
29175027 |
T |
|
| Q |
212 |
gagcgagcctagcatatcgt |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29175026 |
gagcgagcctagcatatcgt |
29175007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University