View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_48 (Length: 240)
Name: NF9893_high_48
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38674841 - 38674619
Alignment:
| Q |
1 |
cacgctattttacttccataattacgtaaccctagttttcaaatctcacctttcactactataagtacaacaatctattcactcctaactcttgcgccaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38674841 |
cacgctattttactaccataattacgtaaccctagttttcaaatctcacctttcactactataaatacaacaatctattcactcctaactcttgcgccaa |
38674742 |
T |
 |
| Q |
101 |
aaccgttcgataaaattccccaactaaattcaacgccgtcagaaccaaatccaatcaacagtcgaagaagatgtacgttgttaagagagacggtcgtcaa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38674741 |
aaccgttcgataaaatcccccaactaaatccaacgtcgtcagaaccaaatccaatcaacagtcgaagaagatgtacgttgttaagagagacggtcgtcaa |
38674642 |
T |
 |
| Q |
201 |
gaggcggttcacttcgacaagat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38674641 |
gaggcggttcacttcgacaagat |
38674619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 223
Target Start/End: Complemental strand, 2062177 - 2062116
Alignment:
| Q |
162 |
tcgaagaagatgtacgttgttaagagagacggtcgtcaagaggcggttcacttcgacaagat |
223 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
2062177 |
tcgaagaagatgtacgttgtggagagagatggtcgtcaagaggcggttcgttttgacaagat |
2062116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University