View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_52 (Length: 236)
Name: NF9893_high_52
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 88 - 204
Target Start/End: Complemental strand, 18096066 - 18095950
Alignment:
| Q |
88 |
gaaacatataacacctcaaaatcacttctgaaatcaattaccgatttaatctcagatcttactaaattcatggtttaattttttcacaaattcagcatta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18096066 |
gaaacatataacacctcaaaatcacttctgaaatcaattaccgatttaatctcagatcttactaaattcatggtttaattttttcaaaaattcagcatta |
18095967 |
T |
|
| Q |
188 |
aatctactaaaataact |
204 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18095966 |
aatctactaaaataact |
18095950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University