View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_high_53 (Length: 231)
Name: NF9893_high_53
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 102 - 214
Target Start/End: Complemental strand, 3220099 - 3219983
Alignment:
| Q |
102 |
gggatattacatttacaactctcatctctataaactcatctt---ttttaactcatcctccattcaaaa-tctcaagtacatttccttaaatatattgta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3220099 |
gggatattacatttacaactctcatctctataaactcatcttcttttttaactcatcctccattcaaaaatctcaagtacatttccttaaatatattgta |
3220000 |
T |
|
| Q |
198 |
gatcattgtatgatatt |
214 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3219999 |
gatcattgtatgatatt |
3219983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University