View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9893_low_28 (Length: 344)

Name: NF9893_low_28
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9893_low_28
NF9893_low_28
[»] chr5 (1 HSPs)
chr5 (2-62)||(34713345-34713405)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 34713345 - 34713405
Alignment:
2 aagattttccgtccattgtcaaactaggaataacatagnnnnnnngaagttaataacatat 62  Q
    ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
34713345 aagattttccgtccattgtcaaactaggaataacatagaaaaaaagaagttaataacatat 34713405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University