View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_low_44 (Length: 265)
Name: NF9893_low_44
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 220
Target Start/End: Original strand, 40208054 - 40208272
Alignment:
| Q |
2 |
caaagaaatatttatacatggaacagtgttggttatgtgtttttatgnnnnnnnnctttatataaattcttggtttttggggggttgaataataagacaa |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40208054 |
caaataaatatttatacatggaacagtgttggttatgtgtttttatgttttttttctttatataaattctgggtttttggggggttgaataataagacaa |
40208153 |
T |
 |
| Q |
102 |
ttccttgggcattggttgtgtggatgatggtatcatttgcatcagtgactggttgctggatcgatgaacatcgtccaaaattaagtgtccctgaaaaatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208154 |
ttccttgggcattggttgtgtggatgatggtatcatttgcatcagtgactggttgctggatcgatgaacatcgtccaaaattaagtgtccctgaaaaatg |
40208253 |
T |
 |
| Q |
202 |
atatctatgaattttaata |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40208254 |
atatctatgaattttaata |
40208272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University