View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_low_58 (Length: 240)
Name: NF9893_low_58
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_low_58 |
 |  |
|
| [»] scaffold0572 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 140 - 225
Target Start/End: Complemental strand, 42734551 - 42734466
Alignment:
| Q |
140 |
atgaaactcacacagtaacagtaccttttcgtacaaaaccctaattctcgtttttcagatgggagaattattgttactgtgaggtg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42734551 |
atgaaactcacacagtaacagtaccttttcgtacaaaaccctaattctcgtttttcagatgggagaattattgttactgtgaggtg |
42734466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 42734680 - 42734626
Alignment:
| Q |
12 |
cagagagtcagattccgagttcagaaaatttgaaacgggatcgacatcaattgaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42734680 |
cagagagtcagattccgagttcagaaaatttgaaacgggatcgacaccaattgaa |
42734626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0572 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0572
Description:
Target: scaffold0572; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 225
Target Start/End: Complemental strand, 8586 - 8501
Alignment:
| Q |
140 |
atgaaactcacacagtaacagtaccttttcgtacaaaaccctaattctcgtttttcagatgggagaattattgttactgtgaggtg |
225 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
8586 |
atgaaactcacacagtaacagtactttttcgtaagaaaccctaattcttgtttttcaggtgggataattattgctactgtgaggtg |
8501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0572; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 8705 - 8660
Alignment:
| Q |
21 |
agattccgagttcagaaaatttgaaacgggatcgacatcaattgaa |
66 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| ||| |||||||| |
|
|
| T |
8705 |
agattccgagttcagaaaacttgaaacaggatcaacaccaattgaa |
8660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 20972805 - 20972724
Alignment:
| Q |
140 |
atgaaactcacacagtaacagtaccttttcgtacaaaaccctaattctcgtttttcagatgggagaattattgttactgtga |
221 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
20972805 |
atgaaacttacacagtaacaatactttttcgtacgaaaccctaattctcgtttttcaggtgggggaattattgttactgtga |
20972724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University